|
TaKaRa
plvx puro vector backbone Plvx Puro Vector Backbone, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plvx puro vector backbone/product/TaKaRa Average 96 stars, based on 1 article reviews
plvx puro vector backbone - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Sino Biological
pcmv3 vector backbone Pcmv3 Vector Backbone, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcmv3 vector backbone/product/Sino Biological Average 94 stars, based on 1 article reviews
pcmv3 vector backbone - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
lentiviral vector Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral vector/product/Addgene inc Average 95 stars, based on 1 article reviews
lentiviral vector - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 lentiviral vector backbone Plko 1 Lentiviral Vector Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 lentiviral vector backbone/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 lentiviral vector backbone - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Kodak
pflag/bap control plasmid ![]() Pflag/Bap Control Plasmid, supplied by Kodak, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pflag/bap control plasmid/product/Kodak Average 90 stars, based on 1 article reviews
pflag/bap control plasmid - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Millipore
mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt ![]() Mission Shrna Plasmid Control Vector With The Insert: Ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt/product/Millipore Average 90 stars, based on 1 article reviews
mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
OriGene
expression plasmids pcmv6-ac-gfp ![]() Expression Plasmids Pcmv6 Ac Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/expression plasmids pcmv6-ac-gfp/product/OriGene Average 90 stars, based on 1 article reviews
expression plasmids pcmv6-ac-gfp - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
hairpin rna shrna plko 1 vector backbones targeting snai2 ![]() Hairpin Rna Shrna Plko 1 Vector Backbones Targeting Snai2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hairpin rna shrna plko 1 vector backbones targeting snai2/product/Addgene inc Average 93 stars, based on 1 article reviews
hairpin rna shrna plko 1 vector backbones targeting snai2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
guide rna expression vector ![]() Guide Rna Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide rna expression vector/product/Addgene inc Average 95 stars, based on 1 article reviews
guide rna expression vector - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Addgene inc
addgene pcdna3 flag ha ![]() Addgene Pcdna3 Flag Ha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/addgene pcdna3 flag ha/product/Addgene inc Average 93 stars, based on 1 article reviews
addgene pcdna3 flag ha - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
OriGene
pcmv6 ac gfp catalogue ps100010 vector ![]() Pcmv6 Ac Gfp Catalogue Ps100010 Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcmv6 ac gfp catalogue ps100010 vector/product/OriGene Average 96 stars, based on 1 article reviews
pcmv6 ac gfp catalogue ps100010 vector - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
recombinant dna pspcas9 bb 2a gfp px458 addgene 48138 puc19 vector backbone new england biolabs e5510s puc19 5 ha h2b mcherry p2a 3 ha ![]() Recombinant Dna Pspcas9 Bb 2a Gfp Px458 Addgene 48138 Puc19 Vector Backbone New England Biolabs E5510s Puc19 5 Ha H2b Mcherry P2a 3 Ha, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant dna pspcas9 bb 2a gfp px458 addgene 48138 puc19 vector backbone new england biolabs e5510s puc19 5 ha h2b mcherry p2a 3 ha/product/New England Biolabs Average 98 stars, based on 1 article reviews
recombinant dna pspcas9 bb 2a gfp px458 addgene 48138 puc19 vector backbone new england biolabs e5510s puc19 5 ha h2b mcherry p2a 3 ha - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: Schwann cell survival mediated by the signaling phospholipid lysophosphatidic acid
doi:
Figure Lengend Snippet: Overexpression of the LPA receptor LPA1/VZG-1 reduces SC apoptosis. (a) SCs transfected with pFLAG/VZG-1 (encoding FLAG epitope-tagged LPA1/VZG-1) or with pFLAG/BAP (encoding FLAG-tagged bacterial alkaline phosphatase control protein), double-labeled for α-FLAG immunofluorescence (red) and fluorescent ISEL (green). Double-labeled, apoptotic transfected cells (arrows), as well as healthy transfected cells (arrowheads), are observed. (Bars = 30 μM.) (b) Overexpression of LPA1/VZG-1 significantly reduces apoptosis resulting from serum withdrawal both with and without a submaximal (0.1 μM) dose of LPA. LPA1/VZG-1 overexpression also modestly, but not significantly, potentiated the effect of a maximal dose (1 μM) of LPA. Bars represent means ± SEM of three experiments performed in triplicate. ∗, P < 0.005 (vs. pFLAG/BAP transfection control within each LPA treatment condition) by ANOVA and Fisher’s protected least significant difference post-hoc analysis.
Article Snippet: SCs were grown on glass coverslips to ≈80% confluency and were transfected with various expression constructs for 3 h by using Lipofectamine Plus (GIBCO) in DMEM/10% FCS. pHA-Akt(K179M) encodes an Akt protein rendered kinase-inactive by a point mutation in the catalytic domain ( 24 , 25 ) and was the kind gift of David Kaplan (McGill University) and Michael Greenberg (Harvard Medical School). pHA-mΔ4–129Akt encodes a constitutively active form of Akt ( 26 , 27 ) and was the kind gift of Richard Roth (Stanford University) and Michael Greenberg. pFLAG/VZG-1 ( 9 ) contains the complete ORF of murine lp A1 /vzg-1 fused to an N-terminal FLAG epitope sequence in the plasmid pFLAG/CMV1 (Kodak/IBI).
Techniques: Over Expression, Transfection, FLAG-tag, Labeling, Immunofluorescence
Journal:
Article Title: Schwann cell survival mediated by the signaling phospholipid lysophosphatidic acid
doi:
Figure Lengend Snippet: Promotion of SC survival by LPA involves Gi and the PI3K/Akt pathway. (a) LPA-dependent survival (“—” lane) is reduced significantly by PTX (200 ng/ml), indicating involvement of Gi, and is blocked completely by wortmannin (Wort.; 30 nM) and LY294002 (LY; 10 μM), indicating dependence on PI3K. Bars represent means ± SEM of 3–4 experiments performed in duplicate. ∗, P < 0.0001 by t test with matched control. Other means were not significantly different from matched controls (i.e., pharmacological inhibitor alone). (b and c) Western blots probed with antibodies specific for Ser-473-phosphorylated Akt (α-phospho-Akt), with parallel control blots probed with antibodies detecting all Akt (α-Akt). Treatment of SCs with LPA induces a transient increase in Akt phosphorylation at a site required for its activation (34) (b) This LPA-induced phosphorylation is blocked by Wort. or LY, but not by the mitogen-activated protein kinase pathway inhibitor PD98059 (PD, c), consistent with data showing that PI3K activation is upstream of Akt activation (34). (d) The ability of 1 μM LPA to inhibit apoptosis is reduced significantly in cells transfected with an expression construct encoding a kinase-inactive form of Akt [HA-Akt(K179M)] compared with control (pFLAG/BAP)-transfected cells. ∗, Significant difference (P < .01, ANOVA with Fisher’s protected least significant difference post-hoc analysis) between these two conditions; data are expressed as percentage of control values (serum-free medium alone) within each transfection condition. Bars represent means ± SEM of three experiments performed in triplicate. (e) A schematic illustrating the proposed signal-transduction pathway important for LPA-mediated survival in SCs. LPA binds to its receptor, LPA1/VZG-1 (see Fig. Fig.4),4), which activates a PTX-sensitive Gi/o family G protein (9); G protein activation leads to the activation of PI3K (which is blocked by Wort. and LY), probably via the βγ subunits (35); PI3K activation leads to the activation of Akt (34), including its phosphorylation at Ser-473; and activated Akt promotes cell survival via mechanisms likely including the phosphorylation of BAD (26).
Article Snippet: SCs were grown on glass coverslips to ≈80% confluency and were transfected with various expression constructs for 3 h by using Lipofectamine Plus (GIBCO) in DMEM/10% FCS. pHA-Akt(K179M) encodes an Akt protein rendered kinase-inactive by a point mutation in the catalytic domain ( 24 , 25 ) and was the kind gift of David Kaplan (McGill University) and Michael Greenberg (Harvard Medical School). pHA-mΔ4–129Akt encodes a constitutively active form of Akt ( 26 , 27 ) and was the kind gift of Richard Roth (Stanford University) and Michael Greenberg. pFLAG/VZG-1 ( 9 ) contains the complete ORF of murine lp A1 /vzg-1 fused to an N-terminal FLAG epitope sequence in the plasmid pFLAG/CMV1 (Kodak/IBI).
Techniques: Western Blot, Activation Assay, Transfection, Expressing, Construct, Transduction
Journal: Nucleic Acids Research
Article Title: CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells
doi: 10.1093/nar/gkac159
Figure Lengend Snippet: Co-transfection assays revealed that RxCas13d has significant off-target effects in Drosophila cells. ( A ) Drosophila DL1 cells were co-transfected with (i) 50 ng of plasmid that constitutively expresses a guide RNA from the U6 promoter as well as HA-tagged catalytically active or dead (R239A, H244A, R858A, and H863A mutations) RxCas13d from the Ubi-p63e promoter, (ii) 225 ng of plasmid that expresses eGFP from the copper-inducible MtnA promoter, and (iii) 225 ng of plasmid that expresses mCherry from the MtnA promoter. 24 h after transfection, CuSO 4 was added and total RNA was isolated after an additional 14 h. Northern blots were then performed. ( B ) Plasmids expressing active RxCas13d and a guide RNA complementary to eGFP (left) or mCherry (right) were employed in the co-transfection assay. Representative Northern blots (20 μg of total RNA/lane) are shown. ImageQuant was used to quantify the relative expression levels of eGFP, mCherry, and RxCas13d mRNAs from three independent experiments. eGFP and mCherry mRNA expression was normalized to the empty vector samples, while RxCas13d mRNA expression was normalized to the random guide RNA samples. RpL32 mRNA served as an endogenous loading control. Data are shown as mean ± SD. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05. ( C ) Same as (B) except that plasmids expressing catalytic dead RxCas13d (dRxCas13d) were used. n.s., not significant.
Article Snippet: The RxCas13d-2A-eGFP expression plasmid (pXR001; Addgene #109049) and the corresponding
Techniques: Cotransfection, Transfection, Plasmid Preparation, Isolation, Northern Blot, Expressing, Control
Journal: Nucleic Acids Research
Article Title: CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells
doi: 10.1093/nar/gkac159
Figure Lengend Snippet: Reducing the expression level of RxCas13d does not diminish the off-target effects. ( A ) Proposed model of Cas13 effector activation. Base pairing between the guide RNA and its target mRNA (green) leads to a conformational change in Cas13 (orange) that activates the endonuclease activity on the surface of the protein. This can result in cis -cleavage/degradation of the target RNA (left) but also trans- cleavage of bystander RNAs (red), resulting in off-target effects (right). This model predicts that increased levels of target mRNA should result in increased off-target effects due to increased numbers of active Cas13 protein in cells. ( B ) Drosophila DL1 cells were transfected with decreasing amounts of RxCas13d/guide RNA expression plasmid, while the amounts of the eGFP (225 ng) and mCherry (225 ng) plasmids transfected were kept constant. Empty vector (pUb-3xFLAG MCS (No BsmBI) plasmid) was added as needed so that 500 ng DNA was transfected in all samples. 24 h after transfection, CuSO 4 was added and total RNA was isolated after an additional 14 h. ( C ) Northern blots (20 μg of total RNA/lane) were used to quantify the relative expression levels of eGFP and mCherry mRNA. Data are shown as mean ± SD, N = 3. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05. n.s., not significant.
Article Snippet: The RxCas13d-2A-eGFP expression plasmid (pXR001; Addgene #109049) and the corresponding
Techniques: Expressing, Activation Assay, Activity Assay, Transfection, RNA Expression, Plasmid Preparation, Isolation, Northern Blot
Journal: Nucleic Acids Research
Article Title: CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells
doi: 10.1093/nar/gkac159
Figure Lengend Snippet: A positive correlation was observed between target mRNA level and RxCas13d off-target effects. ( A ) Drosophila DL1 cells were co-transfected with a constant amount of RxCas13d/guide RNA (50 ng) and mCherry (225 ng) expression plasmids, but variable amounts of eGFP expression plasmid (2, 5, 10, 25 or 50 ng). Empty vector (pUb-3xFLAG MCS (No BsmBI) plasmid) was added as needed so that 500 ng DNA was transfected in all samples. 24 h after transfection, CuSO 4 was added and total RNA was isolated after an additional 14 h. RNA expression levels were then analyzed by RT-qPCR ( B ) or northern blotting ( C ). (B) RT-qPCR was used to quantify the expression of eGFP mRNA in cells transfected with the RxCas13d plasmid expressing a random guide RNA or a guide RNA complementary to eGFP. For each amount of eGFP plasmid transfected, the relative abundance of eGFP mRNA was normalized to the respective random guide RNA samples. Data are shown as mean ± SD, N = 3. (∗) P < 0.05. (C) Northern blots (20 μg of total RNA/lane) were used to quantify the relative expression levels of mCherry and RxCas13d mRNAs. Data are shown as mean ± SD, N = 3. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05. n.s., not significant. A complete table of P -values for all comparisons is provided in .
Article Snippet: The RxCas13d-2A-eGFP expression plasmid (pXR001; Addgene #109049) and the corresponding
Techniques: Transfection, Expressing, Plasmid Preparation, Isolation, RNA Expression, Quantitative RT-PCR, Northern Blot
Journal: Nucleic Acids Research
Article Title: CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells
doi: 10.1093/nar/gkac159
Figure Lengend Snippet: Co-transfection assays revealed PspCas13b has better specificity in Drosophila cells. ( A ) Drosophila DL1 cells were co-transfected with (i) 50 ng of plasmid that constitutively expresses a guide RNA from the U6 promoter as well as HA-tagged catalytically active or dead (H133A and H1058A mutations) PspCas13b from the Ubi-p63e promoter, (ii) 225 ng of plasmid that expresses eGFP from the copper-inducible MtnA promoter, and (iii) 225 ng of plasmid that expresses mCherry from the MtnA promoter. 24 h after transfection, CuSO 4 was added and total RNA was isolated after an additional 14 h. Northern blots were then performed. ( B ) Plasmids expressing active PspCas13b and a guide RNA complementary to eGFP (left) or mCherry (right) were employed in the co-transfection assay. Representative Northern blots (20 μg of total RNA/lane) are shown. ImageQuant was used to quantify the relative expression levels of eGFP, mCherry and PspCas13b mRNAs from three independent experiments. eGFP and mCherry mRNA expression was normalized to the empty vector samples, while PspCas13b mRNA expression was normalized to the random guide RNA samples. RpL32 mRNA served as an endogenous loading control. Data are shown as mean ± SD. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05. No significant changes in expression of the mRNAs encoding PspCas13b or the off-target fluorescent protein were found. ( C ) Same as (B) except that plasmids expressing catalytic dead PspCas13b (dPspCas13b) were used. n.s., not significant.
Article Snippet: The RxCas13d-2A-eGFP expression plasmid (pXR001; Addgene #109049) and the corresponding
Techniques: Cotransfection, Transfection, Plasmid Preparation, Isolation, Northern Blot, Expressing, Control
Journal: Nucleic Acids Research
Article Title: CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells
doi: 10.1093/nar/gkac159
Figure Lengend Snippet: PspCas13b, but not RxCas13d, can be used to specifically deplete a circular RNA in Drosophila cells. ( A ) A three-exon Laccase2 minigene driven by the copper-inducible MtnA promoter can be alternatively spliced to yield a linear mRNA or a circular RNA derived from exon 2. To test the ability of Cas13 effectors to catalyze isoform-specific depletion, guide RNAs were designed that should deplete only the linear RNA (Exon 3 guide), only the circular RNA (BSJ guide), or both the linear and circular RNAs (Exon 2 guide). Drosophila DL1 cells were co-transfected with (i) 50 ng of plasmid that constitutively expresses a guide RNA as well as RxCas13d or PspCas13b effector and (ii) 450 ng of the Laccase2 Exon 1–3 minigene expression plasmid. 24 h after transfection, CuSO 4 was added and total RNA was isolated after an additional 14 h. ( B ) Representative Northern blots (20 μg of total RNA/lane) using an oligonucleotide probe complementary to exon 2 of the Laccase2 minigene. ( C ) ImageQuant was used to quantify the expression levels of linear and circular RNA normalized to the empty vector samples. RpL32 mRNA served as an endogenous loading control. Data are shown as mean ± SD, N = 3. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05.
Article Snippet: The RxCas13d-2A-eGFP expression plasmid (pXR001; Addgene #109049) and the corresponding
Techniques: Derivative Assay, Transfection, Plasmid Preparation, Expressing, Isolation, Northern Blot, Control
Journal: Nucleic Acids Research
Article Title: CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells
doi: 10.1093/nar/gkac159
Figure Lengend Snippet: Quantification of on- and off-target effects of RxCas13d and PspCas13b in human HeLa cells. ( A ) HeLa cells were co-transfected with (i) 300 ng of plasmid that constitutively expresses HA-tagged Cas13 protein followed by a 2A peptide and eGFP, (ii) 200 ng of plasmid that expresses a guide RNA, (iii) 250 ng of plasmid that expresses nanoLuciferase (nLuc) and (iv) 250 ng of plasmid that expresses firefly luciferase (FFLuc). 48 h after transfection, total RNA was isolated and Northern blots performed. (B, C) Guide RNAs complementary to FFLuc were employed in the co-transfection assay. ( B ) Representative Northern blots (20 μg of total RNA/lane) are shown. ImageQuant was used to quantify the relative expression levels of FFLuc, nLuc, and Cas13-2A-eGFP mRNAs. nLuc and FFLuc mRNA expression was normalized to the empty vector (pBEVY-L) samples, while Cas13-2A-eGFP mRNA expression was normalized to the random guide RNA samples. GAPDH mRNA served as an endogenous loading control. Data are shown as mean ± SD, N = 3. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05. ( C ) Relative RNA concentrations obtained from the co-transfection assays when the RxCas13d or PspCas13b expression plasmids were used. Data are normalized to the empty vector samples and shown as mean ± SD, N = 5. (∗) P < 0.05. (D, E) HeLa cells were co-transfected with constant amounts of RxCas13d, guide RNA, and nLuc expression plasmids, but variable amounts of FFLuc expression plasmid (20, 50 or 150 ng). ( D ) RT-qPCR was used to quantify depletion of FFLuc mRNA. For each amount of FFLuc plasmid transfected, the relative abundance of FFLuc mRNA was normalized to the respective random guide RNA samples. Data are shown as mean ± SD, N = 3. (∗) P < 0.05. ( E ) Northern blots (20 μg of total RNA/lane) were used to quantify the relative expression levels of nLuc and RxCas13d-2A-eGFP mRNAs. Data are shown as mean ± SD, N = 3. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05. A complete table of P -values for all comparisons in (D) and (E) is provided in .
Article Snippet: The RxCas13d-2A-eGFP expression plasmid (pXR001; Addgene #109049) and the corresponding
Techniques: Transfection, Plasmid Preparation, Luciferase, Isolation, Northern Blot, Cotransfection, Expressing, Control, Quantitative RT-PCR
Journal: Nucleic Acids Research
Article Title: CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells
doi: 10.1093/nar/gkac159
Figure Lengend Snippet: The extent of RxCas13d off-target effects varies across human cell lines. ( A ) HeLa or HEK293T cells were co-transfected with (i) 300 ng of plasmid that constitutively expresses HA-tagged RxCas13d protein followed by a 2A peptide and eGFP, (ii) 200 ng of plasmid that expresses a guide RNA, (iii) 250 ng of plasmid that expresses Renilla luciferase (RLuc) and (iv) 250 ng of plasmid that expresses nanoLuciferase (nLuc). 48 h after transfection, total RNA was isolated and Northern blots performed. (B–E) Guide RNAs complementary to nLuc or RLuc were employed in the co-transfection assay in HeLa cells ( B , C ) or HEK293T cells ( D , E ). (B, D) Representative Northern blots (20 μg of total RNA/lane) are shown. ImageQuant was used to quantify the relative expression level of nLuc, RLuc, and Cas13-2A-eGFP mRNAs. nLuc and RLuc mRNA expression was normalized to the empty vector (pBEVY-L) samples, while Cas13-2A-eGFP mRNA expression was normalized to the random guide RNA samples. GAPDH mRNA served as an endogenous loading control. Data are shown as mean ± SD, N = 3. For statistical comparisons, data were compared to the random guide RNA samples. (∗) P < 0.05. (C, E) Relative RNA concentrations obtained from the co-transfection assays. Data are normalized to the empty vector samples and shown as mean ± SD, N = 3. (∗) P < 0.05. n.s., not significant.
Article Snippet: The RxCas13d-2A-eGFP expression plasmid (pXR001; Addgene #109049) and the corresponding
Techniques: Transfection, Plasmid Preparation, Luciferase, Isolation, Northern Blot, Cotransfection, Expressing, Control